rs183693 chr5:14109346 A>C
- Sequence
atagatttcacagagaattagtaa[A/C]gctcagggcttcgtaagcttaaaa
- ASB in cell types
- 22RV1 (prostate carcinoma) GM12878 (female B-cells lymphoblastoid cell line) HS-SY-2(Monophasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.13 | -1.33 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.64 | 0.83 | 1.12 | |||
| HS-SY-2(Monophasic synovial sarcoma) | -0.29 | 1.49 | 1.50 |
Items per page:
1 – 3 of 3