rs1840680 chr3:157438240 A>G
- Sequence
ggccccttacacccgatccgacta[A/G]gcgctgcaggagtccactggcccg
- ASB for transcription factors
- PATZ1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PATZ1_HUMAN | -2.45 | 2.39 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP autism, mitral annular calcium, neuroticism, personality disorders (pd) - cluster c, salmonella-induced pyroptosis, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Skin_Sun_Exposed_Lower_leg, Thyroid