rs184086 chr6:156552129 A>G
- Sequence
cagccccccagtcacaagcacctc[A/G]attctgccagccaccacagcagct
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) 2588 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.57 | 0.91 | 1.22 | n/a | No Hit | |||
| STAG1_HUMAN | 2.07 | 0.63 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP apoa2 (apolipoprotein aii), barnes akathisia rating scale, obesity with early age of onset (age >2), triglycerides, waist circumference in controls