rs1847 chr4:118981909 C>T
- Sequence
atgcttcagccaaacaggtctgga[C/T]ggaaacccagtttgcgttcagagg
- ASB in cell types
- Jurkat (T-cells) GM12878 (female B-cells lymphoblastoid cell line) HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Jurkat (T-cells) | 2.33 | -1.60 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.69 | 0.09 | 1.32 | |||
| HeLa (cervical adenocarcinoma) | -2.66 | 1.08 | 2.00 |
Items per page:
1 – 3 of 3