rs1861720 chr2:205964282 A>G
- Sequence
actcagcagaggcacaggcctcaa[A/G]caaaggagggatttccctgagtgc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | -0.33 | 1.16 | 1.15 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, amyotrophic lateral sclerosis (als) age of onset, bipolar disorder, sporadic creutzfeldt-jakob disease, triglycerides change with statins
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Muscle_Skeletal, Testis, Thyroid