rs1863538 chr12:107349998 A>C
- Sequence
accccggtgactgtgagattgaca[A/C]tgcgagagcacaaaatgctagcac
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- NFIL3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFIL3_HUMAN | -1.94 | 2.34 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, eye color, hypertension (early onset hypertension), infant head circumference, major depressive disorder (females), plasma aldosterone concentration, salmonella-induced pyroptosis, schizophrenia, variant creutzfeldt-jakob disease