rs1864980 chr5:138611412 C>A
- Sequence
ccacctagctgattcccctccccc[C/A]acccaccagccgctcgctctgtca
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) heart left ventricle hNSC (neural stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | -0.77 | 1.51 | 1.17 | |||
| heart left ventricle | 2.83 | 0.28 | 1.00 | |||
| hNSC (neural stem cells) | -2.11 | 2.60 | 1.00 |
Items per page:
1 – 3 of 3