rs1867274 chr17:6553611 C>T
- Sequence
ggggcccaaagctctgccttttct[C/T]tccgtgggtgatctactggccaga
- ASB for transcription factors
- RBM25_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | -0.51 | 1.52 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, bipolar disorder, infant head circumference, obesity with early age of onset (age >2), pulse rate, serum creatinine, sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp), triglycerides change with statins
GTEx eQTL Artery_Aorta, Artery_Tibial, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood