rs1882059 chr7:36085371 T>C
- Sequence
ggcacgcggtgcatgcgaagtcag[T/C]agttataactgctcgtctgtgctg
- ASB in cell types
- breast tumor T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | -0.09 | 3.03 | 2.00 | |||
| T47D (invasive ductal carcinoma) | n/a | 2.02 | 1.25 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), urinary albumin-to-creatinine ratio
GTEx eQTL Artery_Tibial, Colon_Sigmoid, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis