rs1882282 chr12:67452349 T>A
- Sequence
ttttattgtagccatactggtggg[T/A]gtgtggtggtatctcactgtggtt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM12890 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- COE1_HUMAN SPIB_HUMAN BACH1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COE1_HUMAN | 1.73 | -1.68 | 1.00 | n/a | No Hit | |||
| SPIB_HUMAN | -0.70 | 1.66 | 2.00 | n/a | No Hit | |||
| BACH1_HUMAN | -1.37 | 1.62 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP birth weight, hdl cholesterol, hdl cholesterol change with statins, serum creatinine, suicide attempts in bipolar disorder (substance free)
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Breast_Mammary_Tissue, Colon_Sigmoid, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood