rs188424 chr11:55707082 C>T
- Sequence
attgttattaattattgcttttct[C/T]ctgtcttcatggaattctatttgc
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) neural progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | 1.31 | -1.01 | 1.00 | |||
| neural progenitors | -2.13 | 2.27 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Anterior_cingulate_cortex_BA24, Brain_Putamen_basal_ganglia, Pancreas, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis