rs1892439 chr1:248686511 A>G
- Sequence
gagctgcttccactctagtctcaa[A/G]ctaaaaatagatctctccaaaact
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM12891 (male B- cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.23 | 1.07 | 1.08 | n/a | No Hit | |||
| STAG1_HUMAN | 1.54 | -0.95 | 1.25 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Cells_EBV-transformed_lymphocytes, Minor_Salivary_Gland, Testis