rs1893491 chr12:49967800 T>C
- Sequence
cgtctcctttcctccgcacgttca[T/C]tcgaatgtgcagagccacatcagc
- ASB in cell types
- stem and progenitor cells GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| stem and progenitor cells | 2.28 | -1.98 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | 0.91 | -0.87 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic