rs1900336 chr11:36266061 G>A
- Sequence
agagttctgttaggtgaagggtct[G/A]ggcctgaggttttcttttgcagga
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) adrenal gland
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | 0.59 | -0.43 | 1.00 | |||
| adrenal gland | -1.91 | 2.40 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Liver, Nerve_Tibial, Pancreas, Testis