rs1913768 chr15:71357205 G>A
- Sequence
gccttgcatcctagctggccccac[G/A]gcttgtgatagtctttagatttgg
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.59 | 0.74 | 1.04 | |||
| HEK293T (embryonic kidney) | 0.08 | 1.38 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP autism, decrease in fev1 (in nonasthmatic participants), hdl cholesterol change with statins, lung function, forced expiratory volume in 1 second (fev1) percent change (in nonasthmatic participants), lung function, forced expiratory volume in 1 second (fev1) percent predicted (in nonasthmatic participants), lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), refractive error, triglycerides change with statins, waist hip ratio