rs193123 chr5:78899989 A>G
- Sequence
tatttgcttaatctttgcaactag[A/G]ttgctgcctccttttcggctctag
- ASB in cell types
- K562 (myelogenous leukemia) CD34+ stem cells-derived erythroblasts H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.88 | 0.10 | 1.99 | |||
| CD34+ stem cells-derived erythroblasts | n/a | 2.96 | 2.00 | |||
| H929 (plasma cell myeloma) | n/a | 1.52 | 2.00 |
Items per page:
1 – 3 of 3