rs193552 chr5:148793036 A>T
- Sequence
ctcaccctgaaggaccctaccacc[A/T]cctttctccctaaccccacttccc
- ASB in cell types
- monocyte-derived dendritic cells
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | -1.66 | 2.61 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1