rs193700 chr16:84511520 C>G
- Sequence
cggccaatgctgtcctgtgtccac[C/G]aggtggcgctcgcgatcaccgcaa
- ASB in cell types
- K562 (myelogenous leukemia) neutrophils from periferal blood hTERT-HME1(Telomerase immortalized cell line) neutrophils
- ASB for transcription factors
- BRCA2_HUMAN TRI22_HUMAN KDM1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRCA2_HUMAN | 2.80 | -2.71 | 1.00 | n/a | n/a | |||
| TRI22_HUMAN | 1.87 | -1.04 | 1.00 | n/a | n/a | |||
| KDM1A_HUMAN | 1.80 | -0.60 | 2.50 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Liver, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis