rs1937999 chr1:41432910 G>T
- Sequence
ctgctgctgcagcgccccctgctg[G/T]cccagaccacgtctgccttgtgcc
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells lymphoblastoid cell line) neutrophils from periferal blood GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.78 | 0.45 | 1.03 | n/a | n/a |
Items per page:
1 – 1 of 1