rs193847 chr7:105940443 A>C
- Sequence
gcctgggggaggctctctcctgtc[A/C]atggagtcctttccctctggcttc
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ZR-75-1 (invasive ductal carcinoma) | 1.28 | 0.15 | 2.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, fasting insulin, general white matter integrity factor, homa-ir, resistance to kuru in aged women despite likely exposure