rs1943580 chr18:30764318 A>G
- Sequence
cagtctcacactcaggaataacat[A/G]gtgtgctccacaactcccattcgt
- ASB in cell types
- MEL1 (Mucosal melanoma)
- ASB for transcription factors
- AHR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AHR_HUMAN | 3.33 | -3.67 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP late onset alzheimers disease, obesity with early age of onset (age >2), premature ovarian failure