rs194516 chr7:90223106 A>G
- Sequence
gatttttccaggaagaataactgc[A/G]tcatagtttatgcagccaacaaat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) 22RV1 (prostate carcinoma) tibial nerve
- ASB for transcription factors
- IKZF1_HUMAN NFAC3_HUMAN IKZF2_HUMAN BMI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 3.60 | -3.94 | 1.25 | n/a | No Hit | |||
| NFAC3_HUMAN | 3.32 | -3.46 | 1.00 | n/a | No Hit | |||
| IKZF2_HUMAN | 2.32 | -0.68 | 1.00 | n/a | n/a | |||
| BMI1_HUMAN | 2.96 | -3.10 | 1.00 | n/a | n/a | |||
| ANDR_HUMAN | -0.72 | 2.82 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 8
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, birth weight, fasting blood glucose, hdl cholesterol change with statins, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood