rs195093 chr6:119308459 C>G
- Sequence
tgacttgatttataatccctacaa[C/G]gccactgatgagtcacatacttaa
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) HUVEC-C (HUVEC, umbilical vein endothelial cells) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- TF65_HUMAN SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.50 | -1.59 | 2.00 | n/a | No Hit | |||
| SMRC1_HUMAN | 0.28 | 1.45 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2