rs1971665 chr19:14785318 T>C
- Sequence
cctcccagctcctcgccccactgg[T/C]tcctctccccatgagtcatgggaa
- ASB in cell types
- SKH1 (chronic myelogenous leukemia, BCR-ABL1 positive)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SKH1 (chronic myelogenous leukemia, BCR-ABL1 positive) | 1.27 | 0.34 | 1.00 |
Items per page:
1 – 1 of 1