rs198198 chr16:24117076 T>A
- Sequence
cgctgcatactgtacttgttgatt[T/A]aaaaaaatgtttccaacagaccga
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.00 | 0.76 | 2.02 | |||
| HEK293 (embryonic kidney) | 0.14 | 0.88 | 1.95 |
Items per page:
1 – 2 of 2