rs198383 chr1:11873583 G>A
- Sequence
tgctcatgacctatagaggcagtg[G/A]aggtctgctggtatttggtggttt
- ASB for transcription factors
- NFIC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFIC_HUMAN | -2.45 | 2.39 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, cystatin c in serum, diastolic blood pressure (dbp), hdl cholesterol change with statins, ldl cholesterol, systolic blood pressure (sbp), total cholesterol change with statins
GTEx eQTL Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood