rs198443 chr11:61738224 G>T
- Sequence
agcccaaagtgagcccccacctgg[G/T]caccctgcctctgtgcagcctcat
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.07 | 1.74 | 1.25 | 0.96 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
