rs198671 chr6:142871043 G>A
- Sequence
actgaaagcgggaccagtgaaacc[G/A]acattttgcctaaaacatggttct
- ASB in cell types
- iPSC (induced pluripotent stem cells)
- ASB for transcription factors
- DUX4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| DUX4_HUMAN | -2.34 | 2.45 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1