rs1991854 chr17:67575329 A>G
- Sequence
ctccttggtgctacctgaacccgg[A/G]tataagggcagcggttatggagtg
- ASB in cell types
- iPS-derived chondrocytes GM02610 (Lymphoblastoid Cell Lines) GM18526 (B – cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | 1.21 | 0.02 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, obesity with early age of onset (age >2), urinary albumin-to-creatinine ratio