rs2001887 chr1:31483076 A>G
- Sequence
ttgagcaagcaggcagtacatgac[A/G]ggggccacatgcactggtggtcag
- ASB in cell types
- HKC8 (kidney proximal tubule cell line) MOLM14 (Adult acute myeloid leukemia) K562 (myelogenous leukemia) GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CDK8_HUMAN EPAS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK8_HUMAN | 1.46 | -0.39 | 1.00 | n/a | n/a | |||
| EPAS1_HUMAN | 1.51 | -0.67 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid, Whole_Blood