rs2003513 chr19:3126217 G>A
- Sequence
tgagggcgggagccaggggacaag[G/A]ctggtgcaggtggcaatgataggt
- ASB in cell types
- foreskin keratinocyte bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.69 | n/a | 2.83 | |||
| bipolar neuron | -0.81 | 1.62 | 1.00 |
Items per page:
1 – 2 of 2