rs2012607 chr22:22943068 G>A
- Sequence
ctttcacagagagggatgtgacct[G/A]gccaaggtccctcatcaggaaagt
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 0.09 | 3.19 | 1.00 |
Items per page:
1 – 1 of 1