rs2013760 chr12:12704449 C>T
- Sequence
ccaagaggcagaggttacagtgag[C/T]cgagatcgtgccactgcactccag
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | 1.59 | -1.20 | 1.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | 1.58 | -0.76 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Lung, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood