rs201932 chr20:17542153 T>G
- Sequence
gagtgttctggagttgcctcttag[T/G]agatcatgagagccaattgctaaa
- ASB in cell types
- GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | -1.27 | 1.79 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP homa-b, hypertension (early onset hypertension), refractive error, suicide attempts in bipolar disorder (substance abuse/dependence), urinary albumin-to-creatinine ratio