rs2029858 chr1:61642134 T>C
- Sequence
ttatttggaggagaaaaggtatca[T/C]gtcacctcctatgacctaggaatt
- ASB in cell types
- LNCaP (prostate carcinoma) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 1.90 | -0.40 | 1.08 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.86 | 1.23 | 1.00 |
Items per page:
1 – 2 of 2