rs2033226 chr6:39214625 G>A
- Sequence
ccctcatgcttggtgctaggtttc[G/A]gatccaatcaggtaaaaaccgagg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 2.21 | -0.36 | 1.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, birth weight, diastolic blood pressure (dbp), eye color, hdl cholesterol, hdl cholesterol change with statins, refractive error, schizophrenia, urinary albumin-to-creatinine ratio, waist hip ratio