rs204688 chr20:562030 T>C
- Sequence
ccaccacacctggcctgacagcca[T/C]gtttttagcttttaaaagcaaaac
- ASB in cell types
- foreskin keratinocyte SU-DHL-2 (anaplastic large cell lymphoma) upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.12 | 2.00 | |||
| SU-DHL-2 (anaplastic large cell lymphoma) | n/a | 2.58 | 1.50 | |||
| upper lobe of left lung | 1.15 | -0.44 | 1.00 |
Items per page:
1 – 3 of 3