rs204979 chr14:77098635 G>C
- Sequence
tgtgtgaggggcaggtgggccctg[G/C]tctagccctgggcgcaaccgccag
- ASB in cell types
- HEK293 (embryonic kidney) HCT-116 (colon carcinoma) transverse colon
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.70 | 0.85 | 1.22 | |||
| HCT-116 (colon carcinoma) | 0.48 | 1.14 | 1.00 | |||
| transverse colon | 2.17 | -2.16 | 1.00 |
Items per page:
1 – 3 of 3