rs20541 chr5:132660272 A>G
- Sequence
taaagaaactttttcgcgagggac[A/G]gttcaactgaaacttcgaaagcat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.57 | 0.94 | 1.06 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI allergic sensitization, asthma, cutaneous psoriasis, hodgkins lymphoma, ige levels, psoriasis, self-reported allergy
GRASP alopecia areata, asthma, asthma, childhood and later onset, asthma, childhood onset, asthma, childhood, later and unknown onset, and severe and industrial asthma, asthma, childhood, later and unknown onset, and severe asthma, atopic dermatitis, classical hodgkin lymphoma (ebv-negative), crohns disease, eye color, homa-ir, hypertension (early onset hypertension), ige in plasma, irritible bowel syndrome, lung function, forced expiratory volume in 1 second (fev1), lung function, forced vital capacity (fvc), lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), neuroblastoma (brain cancer), nodular sclerosis hodgkin lymphoma (ebv-negative), pediatric asthma, psoriasis, psoriasis (cutaneous psoriasis), psoriatic arthritis, rheumatoid arthritis, severe asthma, total classical hodgkin lymphoma, total serum ige, triglycerides, type 2 diabetes
PheWAS abnormal findings on mammogram or breast exam, abnormal results of function studies, abnormal tumor markers, elevated cea or ca 125, abnormality of red blood cells, adverse drug events and drug allergies, adverse effects of antibacterials (not penicillins), adverse effects of cardiac rhythm regulators, adverse effects of sedatives or other central nervous system depressants and anesthetics, agorophobia, social phobia, and panic disorder, angina pectoris, atherosclerosis of renal artery, av block, benign neoplasm of thyroid glands, chronic ischemic heart disease, chronic pharyngitis and nasopharyngitis, complications of gastrostomy, colostomy and enterostomy, corneal edema, dermatomycoses, disorders of fluid, electrolyte, and acid-base balance, displacement of intervertebral disc, disturbance of skin sensation, eating disorder, elevated blood pressure reading, elevated levels of transaminase or lactic acid dehydrogenase, fluid overload, genital prolapse, herpes zoster with nervous system complications, hypercoagulable state, hypertrophy of female genital organs, inflammatory conditions of jaw, intervertebral disc disorder with myelopathy, intervertebral disc disorders, iron metabolism disorder, ischemic heart disease, malignant neoplasm of renal pelvis, multiple myeloma, myeloid leukemia, nerve root lesions, other benign neoplasm of connective and other soft tissue, other disorders of the kidney and ureters, painful respiration, pathological, developmental or recurrent dislocation, pituitary hyperfunction, pulmonary embolism and infarction, respiratory complications, scleritis and episcleritis, seborheic dermatitis, septicemia, suicidal ideation or attempt
GTEx eQTL Artery_Aorta, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid