rs206084 chr13:32268036 A>G
- Sequence
ccagaggagtgcagtaccacacct[A/G]gccagcagagtgcaggtgggattc
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) heart left ventricle LUHMES (lund human mesencephalic cells) FT282 (normal human fallopian tube tissue)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.66 | 0.97 | 1.52 | 1.23 | Weak Discordant | |||
| STAG1_HUMAN | 0.96 | -0.01 | 1.09 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
