rs206085 chr13:32268198 C>T
- Sequence
acaatgactgcttcccattaactc[C/T]tctatgcatctttctgtaaacttt
- ASB in cell types
- MS-1 (Small cell lung carcinoma) LUHMES (lund human mesencephalic cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -0.54 | 0.97 | 1.00 | |||
| LUHMES (lund human mesencephalic cells) | 1.53 | -0.80 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, diastolic blood pressure (dbp), height, serum creatinine, simpson-angus scale, total cholesterol