rs2063878 chr6:120939069 G>T
- Sequence
ataaaagttaaaatagccagaaaa[G/T]gcagcatttttttctctttcactt
- ASB for transcription factors
- SRF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRF_HUMAN | 3.19 | -2.85 | 1.00 | -5.30 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP decrease in fev1/fvc ratio (in asthmatic participants), decrease in fev1/fvc ratio (in nonasthmatic and asthmatic participants), decrease in fev1/fvc ratio (in nonasthmatic participants), hdl cholesterol change with statins