rs206786 chr6:32967402 A>C
- Sequence
ggggatggggaaagagaatgtgac[A/C]aagaattgagatagtaaggataat
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.94 | 0.44 | 2.98 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.84 | 1.08 | 1.09 |
Items per page:
1 – 2 of 2