rs2073798 chr11:64743850 T>G
- Sequence
ggcaaacactccacacccaagtta[T/G]tcgtcggaggccggggacctaagt
- ASB in cell types
- K562 (myelogenous leukemia) GM18486 (Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.68 | 0.26 | 2.01 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 0.99 | -1.00 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.78 | 0.94 | 1.05 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 1.00 | 0.13 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, college completion, hdl cholesterol, height, irritible bowel syndrome, type 1 diabetes, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Colon_Sigmoid, Muscle_Skeletal, Nerve_Tibial, Spleen, Testis, Thyroid, Whole_Blood