rs2074864 chr19:3155738 T>C
- Sequence
tcttgctgtcgctattatggatct[T/C]ggcatatcccagacgtgatggggg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.06 | 0.74 | 2.02 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), comorbid depressive syndrome and alcohol dependence, hdl cholesterol change with statins, neuroblastoma (brain cancer), parkinsons disease, prop taste detection threshold
GTEx eQTL Brain_Cerebellum, Esophagus_Mucosa, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood