rs2076912 chr9:92138320 T>C
- Sequence
tggaccgctgtgcgttctcccaga[T/C]ggagccctaggggttgggggacac
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) neutrophils from periferal blood HeLa-Tet-On neutrophils
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.23 | 0.91 | 1.56 | n/a | No Hit | |||
| RAD21_HUMAN | 2.06 | 2.01 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2