rs208794 chr20:38894236 G>A
- Sequence
ctggcgctgagccctggcttccct[G/A]gggataggggtggggctgtggtgc
- ASB in cell types
- K562 (myelogenous leukemia) GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.10 | -0.01 | 1.97 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 1.17 | -0.94 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Nerve_Tibial, Stomach, Testis