rs2095054 chr9:75238547 C>T
- Sequence
tgtacaactgccatctactgacat[C/T]ttttggtatttcactggcatccta
- ASB in cell types
- T47D (invasive ductal carcinoma) heart left ventricle GM18486 (Lymphoblastoid Cell Lines) GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.02 | 0.50 | 1.18 | |||
| heart left ventricle | -2.53 | 2.87 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -0.22 | 0.99 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -0.56 | 0.69 | 1.00 |
Items per page:
1 – 4 of 4