rs209920 chr1:40315317 G>A
- Sequence
ccccacaaggaggggaaaggagag[G/A]agggggatgaggcctcgctgtgag
- ASB in cell types
- foreskin keratinocyte GSC23 (Glioblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.77 | n/a | 3.00 | |||
| GSC23 (Glioblastoma) | 2.06 | n/a | 3.00 |
Items per page:
1 – 2 of 2