rs2099684 chr1:161530340 A>G
- Sequence
gaaaagtaaggacggaaaacacat[A/G]ttgtcaggagtgggattcgaaccc
- ASB in cell types
- CHL-1 (Melanoma) GM12878 (female B-cells lymphoblastoid cell line) breast tumor xenograft HT1080 (fibrosarcoma)
- ASB for transcription factors
- BRD4_HUMAN TBP_HUMAN ANDR_HUMAN SSRP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 1.89 | 0.71 | 1.52 | n/a | n/a | |||
| TBP_HUMAN | 0.42 | 0.27 | 1.33 | n/a | No Hit | |||
| ANDR_HUMAN | 2.31 | 0.30 | 1.72 | n/a | No Hit | |||
| SSRP1_HUMAN | 2.19 | -0.94 | 2.00 | n/a | n/a | |||
| EP300_HUMAN | 1.81 | 0.81 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 8
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, fasting insulin, ldl cholesterol, total cholesterol, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood